|
| |
 |
|
| ORIGINAL ARTICLE |
|
| Year : 2023 | Volume
: 20
| Issue : 1 | Page : 168-174 |
|
Study the effect of a fixed orthodontic appliance on the oral microbial cavity
Asaad Kareem Al-nafaee, Rasha Jasim Al-warid, Kasem Ahmed Abeas
Department of Microbiology, College of Dentistry, University of Babylon, Babylon, Iraq
| Date of Submission | 19-Dec-2022 |
| Date of Acceptance | 30-Dec-2022 |
| Date of Web Publication | 29-Apr-2023 |
Correspondence Address:
Asaad Kareem Al-nafaee
Department of Microbiology, College of dentistry, University of Babylon, Hillah 51002, Babylon
Iraq
 Source of Support: None, Conflict of Interest: None
DOI: 10.4103/MJBL.MJBL_339_22
Background: Orthodontics is that branch of dentistry specialty dealing with diagnosis, prevention, and correction of malocclusion aiming to enhance oral health, dental function, and esthetics. The presence of a fixed orthodontic appliance within the oral cavity can alter the microbial balance and so the composition of dental plaque. However, the presence of a fixed appliance alters the physiological characteristics of the oral cavity, causing impaired hygiene, a raise in dental plaque collection, and a delay in the spontaneous physiological processes of tooth cleaning that result in pathogenic bacteria colonization, which causes gingival inflammation, periodontal support degradation, and enamel surface alterations. Objective: The study’s objectives were isolated, identification, and molecular detection of microbes associated with orthodontic appliance patients. Materials and Methods: A total of 88 study samples (68 case; 20 control), 29 males and 59 females, aged 14–35 years, underwent fixed orthodontics during the initial stage of treatment. The samples were cultured on enrichment media and selective media, including mitis-salivarius agar, Mitis-Salivarius Bacitracin agar, Lactobacillus MRS agar, Eosin Methylene Blue agar, and Mannitol agar. They cultured in aerobic and anaerobic (10% CO2) conditions. Results: The positive samples were then purified and identified using morphological and biochemical tests. Among the microbial species gram-positive bacteria accounted for 82.3%, gram-negative bacteria 16.2%, and fungi 1.5%. Our results show that on one hand, gram-positive bacteria, Streptococcus mutans make higher percentage (48.5%) compared to other types. On the other hand, the Escherichia coli with 11.7% is the highest percentage of gram-negative bacteria. Conclusion: Bacteria colonization of orthodontic patients was found to be remarkably high compared to that of controls. Finally, the most common bacteria are S. mutans identify using PCR utilizing Sm.479.F/R primer combination. Keywords: Bacteria, fixed orthodontic appliance, MSB agar, Streptococcus mutans
How to cite this article:
Al-nafaee AK, Al-warid RJ, Abeas KA. Study the effect of a fixed orthodontic appliance on the oral microbial cavity. Med J Babylon 2023;20:168-74 |
| Introduction | |  |
Orthodontics is a dental specialty that focuses on treating and enhancing tooth and jaw abnormalities. This can entail using orthodontic tools such as braces to straighten teeth and rectify mismatched bites.[1] Scientific studies have shown that the presence of fixed appliance in the oral cavity of orthodontic patients can change the composition of dental plaque. The structure of dental plaque, metabolism, and composition may change, leads to increase in the number of microorganisms.[2] Dental plaque is thought to be one of the causes of oral cavity illnesses such as caries, gingivitis, periodontitis, and peri-implantitis.[3] The use of fixed appliances alters the physiological characteristics of the oral cavity, causing impaired hygiene, a rise in dental plaque collection, and a delay in the spontaneous physiological processes of tooth cleaning. Because of those reasons, an orthodontic biofilm grows and makes connections with many different parts of the mouth.[4] Occupied by oral cavity bacteria after 1–2 days Predominant gram-positive cocci (Streptococcus) predominate over colonizing bacteria, which form 1–20 layers. The plaque is also home to filamentous and fusiform bacteria, as well as a tiny number of gram-negative cocci toward the apex. Aerobes and facultative anaerobes are the bacteria that live in this stratum (obligate anaerobes are very few).[5] Fixed orthodontic appliances might hamper effective oral hygiene and pose a significant cariogenic challenge. Furthermore, due to the difficulties of maintaining dental cleanliness, orthodontic appliances may alter the subgingival microbiota since orthodontic accessories encourage bacterial plaque retention. That could lead to the growth of pathogenic bacteria, which can cause gum inflammation, loss of periodontal support, and changes to the surface of the enamel.[6] Gingivitis is described as an inflammatory condition caused by microbes. Tooth decay is characterized as a dysbiosis produced by repeated sugar exposure. As a result, dental tissues become demineralized. There is considerable agreement that dental biofilm is the key biological determinant of illnesses development.[7] Using brackets for orthodontics therapy is one of the factors that promotes tooth biofilm preservation owing to cleaning and plaque accumulation issues, and as a result, pH shifts and the development of caries and gingivitis are common.[8] Using orthodontic appliances also enhances the retention of cariogenic bacteria, allowing them to proliferate and thrive, resulting in imponderables in the oral gram and demineralization around the bracket. Streptococcus mutans is recognized to be one of the most significant organisms engaged in cariogenic biofilm and to play a major pathogenic role in tooth decay pathogenesis due to its acid-genic and acidic characteristics.[9] Patients with a fixed orthodontic therapy may experience an increase in gingival plaque formation as well as a periodontal microbial population.[10] Some studies have found that the microbiology of the subgingival plaques of orthodontic patients has changed, and that the amount of periodontal-pathogens in the subgingival plaques has changed dramatically.[11],[12] This study aims to identify and molecular detection of microbes associated with orthodontic patients.
| Materials and Methods | | |
A total of 88 study samples (68 case; 20 control), comprising 29 males and 59 females with the age ranging 14–35 years, underwent fixed orthodontic therapy during the initial stage of treatment. All samples were collected from the private orthodontic clinic and the specialized health center of dentistry in Babylon City, Iraq. The time span of study sample collection was from February to June 2022.
Specimen collection methods
The samples were taken from patients who had fixed orthodontic appliances for at least three weeks. A swab was taken between the orthodontic brackets attachment molar tube or band, the free gingiva margin from the first molar on both sides of the buccal for upper jaw by a sterilized micro applicator (bond micro brush swab). The bond brushes were used because they are the small in size which can reach a narrow area and also carry a good amount of sample as shown in [Figure 1].
Bacterial diagnosis
The sample collected by bond brush swab placed in a plain tube containing 4 ml of sterilized brain heart infusion broth (Candalab, Spain) was then cultured on blood agar (Acumedialab, USA), MacConky agar (Neogen, USA), other selective media such as mitis salivarius agar (Himedia, India), Mitis Salivarius Bacitracin agar (MSB agar), Lactobacillus MRS agar (Himedia, India), Eosin Methylene Blue agar (Himedia, India), and Mannitol agar (Himedia, India). They were incubated condition aerobic and anaerobic incubator candle jar at 37°C plus (10% CO2) for 24–48 hours. A visual inspection is conducted for the determination of growth, fermentation, pigmentation, and colonial shape. The gram staining procedure was performed on the plates, demonstrating the development of colonies. Under a microscope, the colonies were examined to distinguish between gram-positive and gram-negative bacteria. In order to identify the bacteria in each sample based on their physical characteristics, biochemical tests were undertaken. Various gram-positive and gram-negative isolates were identified using the catalase test, citrate utilization test, coagulase test, indole test, lactose fermentation test, and oxidase test. MSB agar is a selective medium for growing S. mutans. It was made by adding selecting agents at the appropriate levels found for the Mitis–Salivarius Agar: 0.2 U/ml of bacitracin antibiotic and 20% (w/v) sucrose. MSB plates were incubated for 72 h at 37°C in a 5% CO2 environment. Then, up to 25 representative S. mutans colonies were chosen from MSB plates.
Genomic identification of S. mutans
The DNA was extracted from a mixture of Streptococcus spp. cultured on Mitis-Salivarius Bacitracin Agar (MSB) using modified protocols described by the manufacturer (FAVORGEN). S. mutans isolates were confirmed by colony polymerase chain reaction using the species- specific pair of sm 479F/R[13] to amplify 479 bp DNA fragment with F: TCGCGAAAAAGATAAACAAACA and R: GCCCCTTCACAGTTGGTTAG. The PCR mixture contain 1× PCR amplification buffer, master mix 10 μL (Promega, USA), 2 μL for each primer, 2 μL DNA template and nuclease free water 4 μL. The thermocycle condition for PCR follows; 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s and 72°C for 45 s and finally 72°C for 5 min. The PCR product was separated on 2% agarose gel (Candalab, Spain).
Statistical analysis
The descriptive statistics, the statistical software for the social sciences, edition 22.0 (SPSS) program was used. Continuous variables were shown using means and standard deviations. To compare the P values of three groups, a chi-square calculator for independent samples was used. P values less than or equal to 0.05 were considered statistically significant, whereas P values higher than 0.05 were considered statistically insignificant.[14]
Ethical consideration
The study was carried out in conformity with the ethical standards outlined in the Helsinki Declaration. Before taking the sample, the patients verbal and analytical consent was obtained. To obtain this permission, a local ethics committee evaluated and approved the study protocol, subject information, and consent form using document number 566 (containing the number and date in 30/01/2022).
| Results | | |
The study includes 88 cases, of which 68 of them have fixed orthodontic appliances with 20 control group at different times. Study subjects consist of 29 males and 59 females. Eighty-eight cases are divided into three age’s groups: the first group includes 43 patients with six controls within the age of 20 years. The second group includes 20 patients with nine controls within the range of 21–30 years old. The last group includes five patients older than 31 years as shown in [Table 1]. | Table 1: Distribution of cases with fixed orthodontic treatment according to gender and age groups
Click here to view |
The microbial isolate diagnosed Microscopically and biochemically. A microbial swab was isolated from patients after three weeks of installing a fixed orthodontic appliance. Noticeably all the samples gave a positive microbial culture. The control samples were taken in swab from healthy people without orthodontic appliances Staphylococcus epidermis isolated from 40% cases while the other 60% samples had no growth. Sixty eight of eighty eight cases were diagnosed with positive microbial growth samples from microbial swabs, shown in [Table 2]. Twenty samples of them were used as controls which were taken from healthy people without orthodontic appliances as shown in [Table 3]. The microbial swabs were divided into three groups based on age (<20 years, 21–30 years and >30 years). | Table 2: Distribution of microbial isolates from the patients with fixed orthodontic appliances according to gram stain and age groups
Click here to view |
 | Table 3: Distribution of microbial isolates from control group (non-orthodontic) according to gram stain and age groups
Click here to view |
Detection of S. mutans by a specific gene
S. mutans isolates were identified using conventional methods such as colonial morphology, microscopic examination, and biochemical tests before being subjected to DNA extraction and PCR assays. The concentration and purity of extracted DNA were determined by using nanodrop. DNA bands were confirmed by gel electrophoresis. The results demonstrated that thirty-three isolates had a detectable Sm479F/R gene with band 479 pb. The gel was photographed by using gel documentation to save the image as shown in [Figure 2]. | Figure 2: Conventional PCR for detection gene. 2% Agarose gel electrophoresis at 85 volt for 45 min for Sm479F/R primer PCR. Products visualized under UV 1ight after staining with ethidiuim bromide. L: Marker DNA Ladder, lanes (13, 15, 18, 19, and 20) only negative. The size of the product is 479 bp molecular weight fragment DNA
Click here to view |
| Discussion | | |
In this study, the results indicated that the prevalence of females (72.1%) is higher than males (27.9%) with P value = 0.06. This result is in good agreement with that found by AL-Gunaid et al.[15] That might be attributed to the fact that females place a higher value on attractiveness compared to males. The patients were selected from ages 14–35 because most of their permanent teeth were complete. This agreed on with Olkun and Sayar[16] and partially agreed on with Shimpo et al.[17] who found that the age of patients ranged 13–35 years. With a significant correlation, age groups 20 have a higher prevalence (63%) of patients than other age groups. Because the teeth shift as a result of pressures exerted on them throughout time, many orthodontic issues are just as readily correctable in adults as they are in children and adolescents. Adults’ bone tissue is denser than that of youngsters, so therapy may take a bit longer. The relationship between the age groups and prevalence of patients was in a reversible relationship. Almansob et al.[18] reported that there was a tendency for older individuals to use orthodontic appliances more than did younger subjects, in disagrees with our finding.
The percentage of gram-positive bacteria isolated from patients’ oral cavities was 82.3%, the percentage of gram-negative bacteria was 16.2%, and the percentage of fungi was 1.5% as shown in [Table 2]. This finding is consistent with the findings of Samiappan et al.[19] who revealed that the majority of microorganisms isolated from orthodontic brackets were gram-positive bacteria with 21 isolates, while gram-negative bacteria of seven isolate. Results recorded that gram-positive bacteria S. mutans in patients with fixed orthodontic appliance were predominant (48.5%) of fixed orthodontics [see [Table 2]] and found that Lactobacillus ssp. was (17.6%) and Staphylococcus aureus was (8.62%). Streptococcus salivarius was (5.88%) and Streptococcus pyogenes with Streptococcus vestibularis was (1.47%). While this result was slightly agreed on with Jing et al.[20] which observed a rise in the pathogen S. mutans as a change in the oral bacterial ecology of patients undergoing long-term permanent orthodontic treatment, that was also agreed by Shirozaki et al.[21] who reported that the S. mutans contamination levels are similar in the different orthodontic ligature types. Also, Farhadian et al.[22] reported that S. mutans is the main microbe that causes caries and that may make orthodontic patients more likely to get caries. The current results showed that Staphylococcus spp. in patients with fixed orthodontic appliances was predominant (8.62%) in fixed orthodontic as shown in [Table 2]. This finding was supported by Pellissari et al.[23] and partially supported by Abbas et al.[24] whose demonstrated that S. aureus bacteria are the most common type of gram-positive aerobic bacteria found in the saliva of people wearing fixed orthodontic appliances, accounting for 38% of the total 15 specimens. Exhibited Staphylococcus spp. (69.5%) in the oral cavity. Because S. aureus can form biofilms and live in certain places, it has been able to develop ways to stay alive, such as ways to avoid the body’s defenses and make antibiotics less effective.[25] The presence of S. aureus in the oral cavity of orthodontics patients and the usage of prostheses were linked to the bacteria’s presence. This emphasizes the significance of proper dental hygiene, as S. aureus can cause dangerous systemic infections through the oral cavity, and the use of prostheses was linked to the bacteria’s presence.[26]
The second frequent bacteria are Lactobacillus spp., which was found in patients with FOA. This result agrees with Al-Lehaibi et al.[27] who found that substantial differences in colony rates of S. mutans and Lactobacillus spp., with number of colonies being more S. mutans than Lactobacillus spp. colonies over the three months at 102 dilution, and their colony mean values were significantly higher (P = 0.05) especially during the period between the 1st and 2nd months. While nearby Marda et al.[28] which found that the insertion of an orthodontic appliance makes it harder to eliminate dental plaque using a toothbrush and floss. They found an increase in cariogenic oral bacteria in T0 and T2, particularly Streptococcus mitis, Streptococcus sobrinus, and Lactobacillus. These results were statistically significant (P value = 0.021, 0.016, 0.031). Lactobacillus was 53% in the oral cavity. The result shows no significant change in Lactobacillus spp.
Streptococcus salivarius was the 3rd predominant bacterial with 5.88% found in patients during orthodontic treatment, and this result agrees on with Gomez et al.[29] The mentioned acid–base physiology of S. salivarius plays an important role and the presence of orthodontic appliances can produce an increase in bacteria if associated with metal alloy. When gram-negative bacteria Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa (11.7%, 2.9%, and 1.47%, respectively) were identified in the present study, E. coli and K. pneumonia were found to be the most frequently detected gram-negative bacteria (11.7%, 2.9%), which is consistent with Lima et al. and Pellissari et al.[23],[30] who found E. coli is especially common in the mouth as a successional community after antibiotic treatment as suggested by Chen et al.[31] Also, people with weakened immune systems and people in hospitals are more likely to get the bacteria. In contrast to our results, Al-Oebady et al.[32] proposed that P. aeruginosa, Klebsiella spp., and Enterobacter species were isolated from fixed orthodontic patients (P. aeruginosa). Four-month bacterial growth was more than one-month bacterial growth and both were greater than the maximum six-month bacterial growth time. It is difficult for germs to persist in the oral cavity over time. The current study found that 1.5% of the collection samples from fixed orthodontic patients were isolated Candida spp., which agrees with Lucchese and Bondemark,[4] who found the prevalent microbial genera identified in group 1 were Candida (12.0%). Yang et al.[33] reported that in the saliva and occlusal plaque of the fixed orthodontics appliance group, a tendency toward greater Candida spp. levels was identified, while the control group included higher levels of S. mutans. Moreover, for S. mutans levels, both the fixed orthodontic and control groups demonstrated a positive connection between saliva and occlusal plaque regarding Candida spp.
The results of this study indicate that the Sm.479.F/R primer set contains these characteristics and might be used for slightly elevated epidemiological investigations of S. mutans infection as well as for better understanding of microbiological role of S. mutans in carious lesions.[13] Wang et al.[34] reported that the effects of S. mutans on caries in the permanent teeth of several residents of a north China town varied. The ratios of S. mutans to total bacteria detected in saliva by real-time PCR utilizing Sm479F/R and 16S RNA primers were shown to correlate strongly with the prevalence of dental caries in the same cohort. These tests may be useful for identifying a person’s dental caries risk. According to the findings of this investigation, the Sm.479.F/R primer combination is highly specific and sensitive for identifying S. mutans in either pure or mixture DNA samples.
| Conclusion | | |
There is no significant statistical gender difference; however, females tend to be predominant over males regarding study sample rate. The number of orthodontic patients under 20 years age group is significantly higher than that in the other age groups. While controls give one type of bacteria that is S. epidermis, the fixed orthodontic patients have many types of microbials such as gram-positive bacteria, gram-negative bacteria, and fungi. The most common isolated bacteria were S. mutans determined by PCR. Microbial isolate from orthodontic patients were found to be high compared to controls.
Acknowledgments
The authors would like to express their gratitude on the private orthodontic clinic and the specialized oral health center for providing us with the necessary samples. And a special thanks to orthodontic patients for their contributions in completing this research.
Declaration of patient consent
The authors certify that they have obtained all appropriate patient consent forms. In the form the patient(s) has/have given his/her/their consent for his/her/their images and other clinical information to be reported in the journal. The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
Financial support and sponsorship
Nil.
Conflicts of interest
The authors declare that there is no competing interest.
| References | | |
| 1. | Etim S, Aikins E, Onyeaso C Normative orthodontic treatment need of Nigerian adolescents—A comparative study of three major ethnic groups. J Adv Med Medical Res 2020;32:78-87.  |
| 2. | Freitas AOA, Marquezan M, Nojima MCG, Alviano DS, Maia LC The influence of orthodontic fixed appliances on the oral microbiota: A systematic review. Dental Press J Orthod 2014;19:46-55. |
| 3. | Mohammed HA, Sahi NM, Ahmed RT, Al-Rubaye AF Antimicrobial activity of some nanoparticles synthesized by laser ablation technique to stopping dental caries. Med J Babylon 2022;19:601-08. |
| 4. | Lucchese A, Bondemark L. In Biological Mechanisms of Tooth Movement, Third Edition, Krishnan V, Kuijpers-Jagtman AM, Davidovitch Z (eds.). John Wiley & Sons, Inc., NY, USA. 2021, pp. 139-58. |
| 5. | Osmólska-Bogucka AE, Zadurska M Microbial changes in subgingival plaque during orthodontic treatment—–literature review. Dent Med Probl 2016;53:118-24. |
| 6. | Müller LK, Jungbauer G, Jungbauer R, Wolf M, Deschner J Biofilm and orthodontic therapy. Oral Biofilms 2021;29:201-13. |
| 7. | Sanz M, Beighton D, Curtis MA, Cury JA, Dige I, Dommisch H, et al. Role of microbial biofilms in the maintenance of oral health and in the development of dental caries and periodontal diseases. Consensus report of group 1 of the Joint EFP/ORCA workshop on the boundaries between caries and periodontal disease. J Clin Periodontol 2017;44:S5-S11. |
| 8. | Figuero E, Nobrega DF, García-Gargallo M, Tenuta LM, Herrera D, Carvalho JC Mechanical and chemical plaque control in the simultaneous management of gingivitis and caries: A systematic review. J Clin Periodontol 2017;44:S116-S34. |
| 9. | Furtado Júnior JHdC, Valadas LAR, Fonseca SGdC, Lobo PLD, Calixto LHM, Lima AGF, et al. Clinical and microbiological evaluation of Brazilian red propolis containing-dentifrice in orthodontic patients: A randomized clinical trial. Evid Based Complement Alternat Med 2020;2020:1-7. |
| 10. | Deleuse M, Meiffren C, Bruwier A, Maes N, Le Gall M, Charavet C Smartphone application-assisted oral hygiene of orthodontic patients: A multicentre randomized controlled trial in adolescents. Eur J Orthod 2020;42:605-11. |
| 11. | Abusleme L, Hoare A, Hong BY, Diaz PI Microbial signatures of health, gingivitis, and periodontitis. Periodontology 2000 2021;86:57-78. |
| 12. | Guo R, Lin Y, Zheng Y, Li W The microbial changes in subgingival plaques of orthodontic patients: A systematic review and meta-analysis of clinical trials. BMC Oral Health 2017;17:1-10. |
| 13. | Zeng Y, Youssef M, Wang L, Alkhars N, Thomas M, Cacciato R, et al. Identification of non- Streptococcus mutans bacteria from predente infant saliva grown on mitis-salivarius-bacitracin agar. J Clin Pediatric Dent 2020;44:28-34. |
| 14. | Hassan NU, Hassan Y, Ahmad PA, Shah OJ, Bhat MY Hepatic artery anomalies and its impact in patients undergoing pancreaticoduodenectmy. A comparative study from Kashmir Valley. Med J Babylon 2022;19:350. |
| 15. | Al-Gunaid TH, Ibrahim AM, Alhazmi KM, Aljohani AA, Eshky RT, Althagafi N Impact of social media on patient’s decision-making toward orthodontic treatment. Saudi J Health Sci 2021;10:132. |
| 16. | Olkun HK, Sayar G Impact of orthodontic treatment complexity on oral health-related quality of life in Turkish patients: A prospective clinical study. Turk J Orthod 2019;32:125. |
| 17. | Shimpo Y, Nomura Y, Sekiya T, Arai C, Okada A, Sogabe K, et al. Effects of the dental caries preventive procedure on the white spot lesions during orthodontic treatment—An open label randomized controlled trial. J Clin Med 2022;11:854. |
| 18. | Almansob Y, Alhammadi M, Luo X, Alhajj M, Zhou L, Almansoub H, et al. Comprehensive evaluation of factors that induce gingival enlargement during orthodontic treatment: A cross-sectional comparative study. Niger J Clin Pract 2021;24:1649. [ PUBMED] [Full text] |
| 19. | Samiappan SC, Pandiyan R, Palanisamy S, Ramalingam S, Saravanan R, Hameed SA Targeting the extracellular polysaccharide production (EPS) by biofilm forming bacteria from orthodontic brackets and wires through antiquorum sensing action of bioactive compounds from curcuma longa and Zingiber officinale. Biomed Pharmacol J 2020;13:1037-45. |
| 20. | Jing D, Hao J, Shen Y, Tang G, Lei L, Zhao Z Effect of fixed orthodontic treatment on oral microbiota and salivary proteins. Exp Ther Med 2019;17:4237-43. |
| 21. | Shirozaki MU, Ferreira JTL, Küchler EC, Matsumoto MAN, Aires CP, Nelson-Filho P, et al. Quantification of Streptococcus mutans in different types of ligature wires and elastomeric chains. Braz Dent J 2017;28:498-503. |
| 22. | Farhadian N, Mashoof RU, Khanizadeh S, Ghaderi E, Farhadian M, Miresmaeili A Streptococcus mutans counts in patients wearing removable retainers with silver nanoparticles vs those wearing conventional retainers: A randomized clinical trial. Am J Orthod Dentofacial Orthop 2016;149:155-60. |
| 23. | Pellissari BA, Sabino GSP, de Souza Lima RN, Motta RHL, Suzuki SS, Garcez AS, et al. Antimicrobial resistance of bacterial strains in patients undergoing orthodontic treatment with and without fixed appliances. Angle Orthod 2021;91:672-9. |
| 24. | Abbas MH, Al-Yasseen AK, Alhamadi WW Prevalence of Staphylococcus aureus among gingivitis in patient with orthodontic wires in Kufa City/Iraq. Pakistan J Biotechnol 2017;14:91-6. |
| 25. | Khan AS, Alshaia A, AlDubayan A, Alarifi S, Alamri A, Aldossary H, et al. Preparation of nano-apatite grafted glass-fiber-reinforced composites for orthodontic application: Mechanical and in vitro biofilm analysis. Materials 2022;15:35043504. |
| 26. | Azmi AH, Adnan SNA, Ab Malik N The prevalence of Staphylococcus aureus in the oral cavity of healthy adults in Malaysia. Sains Malaysiana 2020;49:583-591. |
| 27. | Al-Lehaibi WK, Al-Makhzomi KA, Mohammed HS, Enezei HH, Alam MK Physiological and immunological changes associated with oral microbiota when using a thermoplastic retainer. Molecules 2021;26:1948. |
| 28. | Marda A, Elhamzaoui S, El Mansari A, Souly K, Farissi F, Zouhdi M, et al. Evaluation of changes in cariogenic bacteria in a young Moroccan population with fixed orthodontic appliances. Int J Dent 2018;2018:1-4. |
| 29. | Gomez DLS, Lozano AS, Madla HF, Alanis GRC-H, Guadalupe E, Capetillo T, et al Streptococcus: An orthodontic point of view. Int J Appl Dental Sci 2021;7(3 Part D):237-41. |
| 30. | Lima ABM, Leão-Vasconcelos LSNO, Costa DM, Vilefort LOR, André MCDPB, Barbosa MA, et al. Pseudomonas spp. isolated from the oral cavity of healthcare workers from an oncology hospital in midwestern Brazil. Rev Inst Med Trop São Paulo 2015;57:513-4. |
| 31. | Chen Y, Wong WK, Seneviratne JC, Huang S, McGrath C, Hagg U Associations between salivary cytokines and periodontal and microbiological parameters in orthodontic patients. Medicine (Baltimore) 2021;100:e24924. |
| 32. | Al-Oebady MAH, Hanfoosh HS, Jabbar AM, Witwit SS Effect of fixed orthodontic appliances on the change of the oral bacteria and Candida species in AL-Samawah city, Iraq. J Pharmaceut Sci Res 2019;11:1092-6. |
| 33. | Yang F, Dinis M, Haghighi F, He X, Shi W, Tran NC Oral colonization of Candida albicans and Streptococcus mutans in children with or without fixed orthodontic appliances: A pilot study. J Dent Sci 2022;17:451-8. |
| 34. | Wang Z-Y, Wang J-Q, Zhou Y, Zhao D, Xiao B Quantitative detection of Streptococcus mutans and bacteria of dental caries and no caries groups in permanent teeth from a north China population. Chin Med J (Engl) 2012;125:3880-4. |
[Figure 1], [Figure 2]
[Table 1], [Table 2], [Table 3]
|
Search Pubmed for